Data Management
Advanced data transfer, sharing, and management powered by Globus.
Designed to deliver NGS data from sequencing centers to the integrated analysis platform quickly, securely, and reliably. Globus is used to move hundreds of terabytes of data each month and is the preferred file transfer capability at dozens of research campuses and sequencing centers.
Workflow
Extensible analysis environment powered by Galaxy workflow platform.
Enables construction of custom pipelines, drawing from a workbench made up of more than 1500 applications and algorithms. Additional tools may be rapidly integrated to extend the scope of your pipelines.
Computation
Scalable, elastic computational infrastructure powered by Amazon Web Services.
Provides virtually unlimited compute and storage capabilities that can dynamically adjust to varying workload and data storage requirements Platform flexibility to take advantage of tools that run more efficiently on a different platform (e.g. GPU, mapReduce, MPI).
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCGAGACAGCGAGCATGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCGAGACAGCGAGCATGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAA
We have published our research on Globus Genomics in a variety of forums.