A solution as cutting-edge as your research.
Globus Genomics combines state-of-the-art algorithms, data management tools, a graphical workflow environment, and an elastic computing infrastructure. We take care of IT complexity so you can focus on your research.
Scalability and flexibility for big genomics data.
Genome sequencing is notoriously data-intensive. We make it easy to manipulate, store, and share your data, no matter how big it gets.
Your workflows, simplified.
We help you easily connect and configure all the tools you need to automate your pipelines.
Let the cloud power your analysis.
Globus provides the data management solution using Amazon's compute cloud. The efficiencies are all yours.
Research without boundaries.
Your research knows no bounds—neither should your data. Globus Genomics works in your browser, so you can run your analyses from anywhere.
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCGAGACAGCGAGCATGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCGAGACAGCGAGCATGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAA